View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19564_high_8 (Length: 369)
Name: NF19564_high_8
Description: NF19564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19564_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 24 - 352
Target Start/End: Complemental strand, 50608993 - 50608665
Alignment:
| Q |
24 |
aacccccatcctgccttgcttcaattttgatcctccttctcttcacttctcggtgacgctaacnnnnnnnnnnnngcgattcagaccatatccgaatctc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| | ||||| |
|
|
| T |
50608993 |
aacccccatcctgccttgcttcaattttgatcctccttctcttcacttctcggtgacgctaacctctctctctctgcgattcagatcatatctggatctc |
50608894 |
T |
|
| Q |
124 |
atatcttgctttggtaatctctctgctacaatcactacattgcctacctcattccagatccaatagttcctaacaacgcgattcannnnnnnnnnnnnnn |
223 |
Q |
| |
|
| ||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50608893 |
agatcctgctttggtaatctctctactacaatcactacattgcctacctcattccagatgcaatagttcctaacaacgcgattcatttttatttttattt |
50608794 |
T |
|
| Q |
224 |
nngcagattcaattcatcactagtagaataaccattttcctttcctcatttcaattctccaatcgaaaaaatggtaactcatcttcgtcttcaccgctac |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50608793 |
ttgcagattcaattcatcactagtagaataaccatttttctttcctcattttaattctccaatcgaaaaaatggtaactcatcttcgtcttcaccgctac |
50608694 |
T |
|
| Q |
324 |
tttcatatttcactacttcatcgtgtttt |
352 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
50608693 |
tttcatatttcactacttcatcgtgtttt |
50608665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University