View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19564_low_13 (Length: 257)
Name: NF19564_low_13
Description: NF19564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19564_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 17 - 242
Target Start/End: Original strand, 4109273 - 4109498
Alignment:
| Q |
17 |
atgaatcagcagaaacacgcatccaccgtctcatatcagaacatccagttatcatcttcacacgttcctcttgctgcatgtgtcatgtcatgaagaagct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4109273 |
atgaatcagcagaaacacgcatccaccgtctcatatcagaacatccagttatcatcttcacacgttcctcttgctgcatgtgtcatgtcatgaagaagct |
4109372 |
T |
 |
| Q |
117 |
tctctccaccataggtgttaatcccaccgtcatcgaattagacgacaacgagatcgcctctttgtcgtctgacgatgacgatgatcttgcttccgtcctc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4109373 |
tctctccaccataggtgttaatcccaccgtcatcgaattagacgacaacgagatcgcctctttgtcgtctgacgatgacgatgatcttgcttccgtcctc |
4109472 |
T |
 |
| Q |
217 |
cgtaaccgctctcctgctgtcttcat |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4109473 |
cgtaaccgctctcctgctgtcttcat |
4109498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 26 - 171
Target Start/End: Complemental strand, 48154189 - 48154041
Alignment:
| Q |
26 |
cagaaacacgcatccaccgtctcatatcagaacatccagttatcatcttcacacgttcctctt---gctgcatgtgtcatgtcatgaagaagcttctctc |
122 |
Q |
| |
|
||||||| || ||| |||| |||||||||||||| || || ||||||||||| || ||||| | |||||||||| |||||||||| ||| || |||| |
|
|
| T |
48154189 |
cagaaactcgaatcaaccgcctcatatcagaacaccctgtcatcatcttcacccgatcctcctcatgctgcatgtgccatgtcatgaggaatctcctctt |
48154090 |
T |
 |
| Q |
123 |
caccataggtgttaatcccaccgtcatcgaattagacgacaacgagatc |
171 |
Q |
| |
|
|||||| || ||| |||||||||| ||| |||| || |||||||||||| |
|
|
| T |
48154089 |
caccatcggcgttcatcccaccgttatccaattggatgacaacgagatc |
48154041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University