View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19565_high_7 (Length: 227)
Name: NF19565_high_7
Description: NF19565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19565_high_7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 39091066 - 39090845
Alignment:
| Q |
19 |
agtcgaccgatctcaaatcaatgaatgagatcaattaatgcatctaaaaatgtgtagttt------tgt-------tttttgtttgtgttatcaattaat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
39091066 |
agtcgaccgatctcaaatcaatgaatgagatcaattaatgcatctaaaaatgtgtagtttggattatgtagttttgtttttgtttgtgttatcaattaat |
39090967 |
T |
|
| Q |
106 |
acaatttcttgtacaataatctttccatctatccatagtgaccacacaacagacaaccaaatcagatgtctgattctctttaactttttatctcgaaaca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39090966 |
acaatttcttgtacaataatctttccatctatccatagtgaccacacaacagacaaccaaatcagatgtctgattctctttaactttttatctcgaaaca |
39090867 |
T |
|
| Q |
206 |
tatcaccatgttgatgcaagtt |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39090866 |
tatcaccatgttgatgcaagtt |
39090845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University