View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19565_high_8 (Length: 224)

Name: NF19565_high_8
Description: NF19565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19565_high_8
NF19565_high_8
[»] chr8 (1 HSPs)
chr8 (1-218)||(40729284-40729501)


Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 40729284 - 40729501
Alignment:
1 aggtgagagggtggagcgaatgtgagatcgaatacgagcttggtagagttgtttctcttgttcgagaaggttacgctgtttctctttggcgcgtttttcg 100  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40729284 aggtgagagagtggagcgaatgtgagatcgaatacgagcttggtagagttgtttctcttgttcgagaaggttacgctgtttctctttggcgcgtttttcg 40729383  T
101 tgcatacgtttccatttccatttgcttacgccgccggggaaggtgcgaggaccgccacccatgttacggaggagacggaggttccaggctgttagtgacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40729384 tgcatacgtttccatttccatttgcttacgccgccggggaaggtgcgaggaccgccacccatgttacggaggagacggaggttccaggctgttagtgacc 40729483  T
201 atgatgctgatgatgatg 218  Q
    ||||||||| ||||||||    
40729484 atgatgctgctgatgatg 40729501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University