View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19565_low_11 (Length: 220)
Name: NF19565_low_11
Description: NF19565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19565_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 35 - 204
Target Start/End: Complemental strand, 29016724 - 29016555
Alignment:
| Q |
35 |
aattaaaaacaaaggtcaatgttgttgtttttgattcacaacatcaacactagtgccacatgacaagaacttatgaaacatccgaaacaaagtattacaa |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29016724 |
aattaaaaacaaaggtcaatgttgttgtttttgattcacaacatcaacactagtgccacatgacaagaacttatgaaacatccgaaacaaagtattacaa |
29016625 |
T |
|
| Q |
135 |
gaaatttccttcattttacttaaaaccaaacacttattccttcttctactttgatttcttttcttctttc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29016624 |
gaaatttccttcattttacttaaaaccaaacacttattccttcttctactttgatttcttttcttctttc |
29016555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University