View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19566_high_4 (Length: 276)
Name: NF19566_high_4
Description: NF19566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19566_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 71 - 176
Target Start/End: Original strand, 12236643 - 12236758
Alignment:
| Q |
71 |
ctcttatattatttgattccaaaatttgtactaac----------actccaagttaaagttattgctttaattattcttaaactttatcttagattatac |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12236643 |
ctcttatattatttgattccaaaatttgtactaacttgtaacaacactccaagttaaagttattgctttaattattcttaaactttatcttagattatac |
12236742 |
T |
 |
| Q |
161 |
tacaagaacagtaatt |
176 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
12236743 |
tacaagaacagtaatt |
12236758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University