View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19567_high_17 (Length: 232)
Name: NF19567_high_17
Description: NF19567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19567_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 212
Target Start/End: Complemental strand, 24864209 - 24864014
Alignment:
| Q |
17 |
aaaaaagagtgtacctgggatgattttggaatggaaaaggaatcatgattgagtgaagaggaaaggagcgttggtgcaggaagggaaaggaagagatgaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24864209 |
aaaaaagagtgtacctgggatgattttggaatggaaaaggaatcatcattgagtgaagaggaaaggagcgttggtgcaggaagggaaaggaggagatgaa |
24864110 |
T |
 |
| Q |
117 |
tgttgaggtgaggtggttttgttgtgcatggaaatgtgagagaacgaaatggagtgtggaacatgtgaatcactagttggcaagaattcatgaact |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24864109 |
tgttgaggtgaggtggttttgttgtgcatggaaatgtgagagaacgaattggagtgtggaacatgtgaatcactagttggcaagaattcatgaact |
24864014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University