View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19567_high_18 (Length: 221)
Name: NF19567_high_18
Description: NF19567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19567_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 8 - 203
Target Start/End: Complemental strand, 36282315 - 36282122
Alignment:
| Q |
8 |
cgaagaaaatccatgaggctatatgtatcgtaccatgttttaacaaaactattacagtcttcaatgggtgcaaaacatgtctggagtgactgtggttgtt |
107 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36282315 |
cgaagataatccatgaggctat--gtatcgtaccatgttttaacaaaactattacagtcttcaatgggtgcaaaacatgtctggagtgactgtggttgtt |
36282218 |
T |
 |
| Q |
108 |
tgtagggaaggaaggtttaaaatattttaatgcaaattagagttacaatggtttattgtggtaacggtaatgattattataactctttgttttgat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36282217 |
tgtagggaaggaaggtttaaaatattttaatgcaaattagagttacaatggtttattgtggtaacggtaatgattattataactctttgttttgat |
36282122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University