View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19567_low_11 (Length: 311)
Name: NF19567_low_11
Description: NF19567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19567_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 6 - 304
Target Start/End: Complemental strand, 734315 - 734017
Alignment:
| Q |
6 |
atttatctcgtggtacgaatcattccctttcgatttgagttgtgagatcaagattgaatgtctaaagtttcgacttaagagttaataaatagattggttt |
105 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
734315 |
atttatctcgcggtacggttcattccctttcgatttgagttgtgagatcaagattgaatgtctaaagtttcgacttaagagttaataaatagattggttt |
734216 |
T |
 |
| Q |
106 |
aaaattgtaagtacctgtcaaagtaacccctcgtttttgtgaattagcaaatacatccacaaaattgtaaaatatcattcaaagtggttgatatgttgac |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
734215 |
aaaattgtaagtacctgtcaaagtaacccctcgtttttgtgaattagcaaatacatccacaaaattgtagaatatcattcaaagtggttgatatgttgac |
734116 |
T |
 |
| Q |
206 |
ttctacagttagacttagaagttataatgtgaaatgctaactagacgtgttgcatcagatgttgatccgacatcaatgcctatgaaatttagttcatct |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
734115 |
ttctacagttagacttagaagttataatgtgaaatgttaactagacatgttacatcagatgttgatccgacatcaatgcctatgaaatttagttcatct |
734017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University