View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19567_low_14 (Length: 253)
Name: NF19567_low_14
Description: NF19567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19567_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 68 - 230
Target Start/End: Original strand, 30783481 - 30783647
Alignment:
| Q |
68 |
ttgtagatcagtagacctatttgagggaaacagaacaactctcctaccgtctgttttaactactaacactcaaattcaaaaccttacttaaggggaactg |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30783481 |
ttgtagatcagtagacctatttgagggaaacagaacaactctcctaccgtctattttaactactaacactcaaattcaaaaccttacttaaggggaactg |
30783580 |
T |
 |
| Q |
168 |
gattactttaatag----ttgcactagacttaatataacatatgagctgcatctctagtatgtccaa |
230 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30783581 |
gattactttaatagttgcttgcactagacttaatataacatatgagctgcatctctagtatgtccaa |
30783647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 14 - 78
Target Start/End: Original strand, 30783397 - 30783461
Alignment:
| Q |
14 |
ttattctggtgtataaccttctgtatatcaaagccatattaaatctaattcaagttgtagatcag |
78 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30783397 |
ttattctgatgtataaccttctgtatatcaaagccatattaaatctaattcaagttgtagatcag |
30783461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University