View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19567_low_17 (Length: 232)

Name: NF19567_low_17
Description: NF19567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19567_low_17
NF19567_low_17
[»] chr8 (1 HSPs)
chr8 (17-212)||(24864014-24864209)


Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 212
Target Start/End: Complemental strand, 24864209 - 24864014
Alignment:
17 aaaaaagagtgtacctgggatgattttggaatggaaaaggaatcatgattgagtgaagaggaaaggagcgttggtgcaggaagggaaaggaagagatgaa 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||    
24864209 aaaaaagagtgtacctgggatgattttggaatggaaaaggaatcatcattgagtgaagaggaaaggagcgttggtgcaggaagggaaaggaggagatgaa 24864110  T
117 tgttgaggtgaggtggttttgttgtgcatggaaatgtgagagaacgaaatggagtgtggaacatgtgaatcactagttggcaagaattcatgaact 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
24864109 tgttgaggtgaggtggttttgttgtgcatggaaatgtgagagaacgaattggagtgtggaacatgtgaatcactagttggcaagaattcatgaact 24864014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University