View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19569_low_3 (Length: 432)
Name: NF19569_low_3
Description: NF19569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19569_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 24 - 414
Target Start/End: Complemental strand, 32726586 - 32726187
Alignment:
| Q |
24 |
ggatgaggaagaagaagaaatggaaacaacaac---------aacaacgacaataaaaacgcaagaagttggtgatgattcaaaagggctaaaactagtg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726586 |
ggatgaggaagaagaagaaatggaaacaacaaccacaacaacaacaacggcaataaaaacgcatgaagttggtgatgattcaaaagggctaaaactagtg |
32726487 |
T |
 |
| Q |
115 |
cacctattgatggctggcgcggaagccttaaccggttcaaccaaaaaccgtgacttagctcgagtgatattgatccggctcaaggaattagtctcacaac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726486 |
cacctattgatggctggcgcggaagccttaaccggttcaaccaaaaaccgtgacttagctcgagtgatattgatccggctcaaggaattagtctcacaac |
32726387 |
T |
 |
| Q |
215 |
atgctaacggctccaacatggagagacttgccgctcatttcaccgaagcccttcatggactactagaaggtgctgggggtgcgcataataaccaccatca |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726386 |
atgctaacggctccaacatggagagacttgccgctcatttcaccgaagcccttcatggactactagaaggtgctgggggtgcgcataataaccaccatca |
32726287 |
T |
 |
| Q |
315 |
ccacaacaacaacaaacattacctcaccacaaatggtccccgcgacaaccaaaacgacacacttgctgctttccaactacttcaagacatgtcaccttac |
414 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726286 |
ccacaacaacaacaaacattacctcaccacaaatggtccccacgacaaccaaaacgacacacttgctgctttccaactacttcaagacatgtcaccttac |
32726187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University