View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1956_high_10 (Length: 335)
Name: NF1956_high_10
Description: NF1956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1956_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 15 - 318
Target Start/End: Original strand, 46040705 - 46041008
Alignment:
| Q |
15 |
gatgaattagtagaagccataatgccgaacatgaatgcagaagtattggtgaatcaagaacaacttataggtgtgttcaagtgcttcgatcgcgatggga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46040705 |
gatgaattagtagaagccataatgccgaacatgaatgcagaagtattggtgaatcaagaacaacttataggtgtgttcaagtgcttcgatcgcgatggga |
46040804 |
T |
 |
| Q |
115 |
atggattcatttcagcagctgaattggctggagcaatggctaaaatgggtcagccacttacatacaaagagcttattgagatgattagagaggcagatat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46040805 |
atggattcatttcagcagctgaattggctggagcaatggctaaaatgggtcagccacttacatacaaagagcttattgagatgattagagaggcagatat |
46040904 |
T |
 |
| Q |
215 |
ggatggtgatggtgttattagttttagtgagtttgctactattatggctcgatctgcttctgatttattaggagtgtttgaatacagaaacaaaacacat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46040905 |
ggatggtgatggtgttattagttttagtgagtttgctactattatggctcgatctgcttctgatttattaggagtgtttgaatacagaaacaaaacacat |
46041004 |
T |
 |
| Q |
315 |
tcat |
318 |
Q |
| |
|
|||| |
|
|
| T |
46041005 |
tcat |
46041008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 217 - 280
Target Start/End: Original strand, 29582364 - 29582427
Alignment:
| Q |
217 |
atggtgatggtgttattagttttagtgagtttgctactattatggctcgatctgcttctgattt |
280 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| ||| ||||| ||| ||| ||||||| |
|
|
| T |
29582364 |
atggtgatggtgttattagtttcaatgagtttgctaccattttggctaaatcagctgctgattt |
29582427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University