View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1956_low_9 (Length: 378)
Name: NF1956_low_9
Description: NF1956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1956_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 51563212 - 51563452
Alignment:
| Q |
10 |
aagaatatgggatgtgggtttatcgcgtcattgtcgagtcccattatattttgaagcagttttgaggttccaaagatccacaatatgagttagcgtcgtc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
51563212 |
aagaatatgggatgtgggtttatcgcgtcatcgtcgagtcccattatattttgaagcagttttgaggttccaaagatccacaatatgagttagcaacatc |
51563311 |
T |
|
| Q |
110 |
gagaaagaatcaacttcatcgcatcaagaatgaattaatctcatatgaaccacaaataatctaattgaatcaaattattttgatgaagcaatctaaattg |
209 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51563312 |
gagaaataatcaacttcatcgcatcaagaatgaattattctcgtatgaaccacaaataatctaattgaatcaaattattttgatgaagtaatctaaattg |
51563411 |
T |
|
| Q |
210 |
aaccaaactatatgtttgttcagtctttggatcaaatgact |
250 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
51563412 |
aaccaaactatatgtttgtttagtctttggatcaaacgact |
51563452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 240 - 351
Target Start/End: Original strand, 51563473 - 51563584
Alignment:
| Q |
240 |
atcaaatgactggtatcatggtgggtgtgtttgaatcacgacaacccaccgtgatttttcataagttatattttattgcttgtgcaaaatggattaccta |
339 |
Q |
| |
|
|||| ||| |||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| ||||||||| |
|
|
| T |
51563473 |
atcatatgtctggtatcatggtgagtgtgtctgaatcacgacaacccaccgtgatttttcataaattatattttattgcttttgcaaaatagattaccta |
51563572 |
T |
|
| Q |
340 |
gattctgacata |
351 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51563573 |
gattctgacata |
51563584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University