View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19570_high_11 (Length: 339)
Name: NF19570_high_11
Description: NF19570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19570_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 2 - 326
Target Start/End: Original strand, 49056832 - 49057139
Alignment:
| Q |
2 |
ttactcccaatgatcactactatatata--agttggagttggaagtggaagggatttttgatgatattctcaattctacctgtagaagtttggaagtgga |
99 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49056832 |
ttactcccaatgatcactactatatatataacttggagttggaagtggaagggatttttgatgatattttcaattctacctgtagaag------------ |
49056919 |
T |
 |
| Q |
100 |
acggaagtttggaagtgtattagccttgctatgtgtagtcagacacaagcccaaataggaggtgttaggcctcgacaaccaacatagaactttgttgttg |
199 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49056920 |
-------tttggaagtgtattagccttgctatgcgtagtcagacacaagcccgaataggaggtgttaggcctcgacaaccaacataaaactttgttgttg |
49057012 |
T |
 |
| Q |
200 |
ctttttataagggagtttatattttgctgttttgtctctctttgttggtgcttcgggccttgcttcagctattcagttctctttggcggggnnnnnnngg |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
49057013 |
ttttttataagggagtttatattttgctgttttgtgtctctttgttggtgcttcgggccttgctttagctattcagttctctttggcggggtttttttga |
49057112 |
T |
 |
| Q |
300 |
gattgcagattattttcgattttgtct |
326 |
Q |
| |
|
|||||||||||||||||| |||||||| |
|
|
| T |
49057113 |
gattgcagattattttcggttttgtct |
49057139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University