View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19570_high_18 (Length: 251)
Name: NF19570_high_18
Description: NF19570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19570_high_18 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 26 - 251
Target Start/End: Original strand, 42680535 - 42680759
Alignment:
| Q |
26 |
caatgtatttctaattcttcttttaatctttttgcttaactatttcatttgcagaacgaaacatgcagcaggaaatgtgagtcaaacttctgttcaggta |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42680535 |
caatgtatttctaattcttcttttaatctttttgcctaactatttcatttgcagaacgaaacatgcagcaggaaatgtgagtcaaacttctgttcaggtg |
42680634 |
T |
|
| Q |
126 |
caattttatatatagtttattggattaagtttaannnnnnnnnacgatgtatctatgttgttgatgaacaaaaatgtactaagtaaagtatatgtattat |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42680635 |
caattttatatatagtttattggattaagtttaa-ttttttttatgatgtatctatgttgttgatgaacaaaaatgtactaagtaaagtatatgtattat |
42680733 |
T |
|
| Q |
226 |
aattttggattgacatatatagtgcc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42680734 |
aattttggattgacatatatagtgcc |
42680759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University