View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19570_high_27 (Length: 220)
Name: NF19570_high_27
Description: NF19570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19570_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 73 - 204
Target Start/End: Complemental strand, 10010587 - 10010455
Alignment:
| Q |
73 |
agttcttcatgtactttctaaaaaatttgcttcgtattgtgtagatatgtgttgagaaaatcaataatttcatgttaacct-tttggtcttttgaaatgt |
171 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10010587 |
agttcttcatgtacttcctaaaaaatttgcttcgtattgtgtagatatgtgttgagaaaatcaataatttcatgttaacctctttggtcttttgaaatgt |
10010488 |
T |
 |
| Q |
172 |
agatatataggtcgattggaatcggcttctgtt |
204 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
10010487 |
agatatataggttgattggaatcggcttctgtt |
10010455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University