View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19570_low_13 (Length: 294)
Name: NF19570_low_13
Description: NF19570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19570_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 46 - 221
Target Start/End: Original strand, 35628149 - 35628324
Alignment:
| Q |
46 |
ttagttataaaatcaaactctaactataaaatgagaaaaattagaatgatacatacctgaactatcagatgaagttgaaggacttagggctaatcctttt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35628149 |
ttagttataaaatcaaactctaactataaaatgagaaaaattagaatgatacatacctgaactatcagatgaagttgaaggacttagggctaatcctttt |
35628248 |
T |
|
| Q |
146 |
ggtgacattgccatatcttcattattttatcaaacaaacaaatttaagttgccacagatgatcaaggtaatttcaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35628249 |
ggtgacattgccatatcttcattattttatcaaacaaacaaatttaagttaccacagatgatcaaggtaatttcaa |
35628324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 233 - 276
Target Start/End: Original strand, 35628316 - 35628359
Alignment:
| Q |
233 |
taatttcaaataattgcttagcaacaataaattaacttgtggaa |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35628316 |
taatttcaaataattgcttagcaacaataaattaacttatggaa |
35628359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University