View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19570_low_27 (Length: 220)

Name: NF19570_low_27
Description: NF19570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19570_low_27
NF19570_low_27
[»] chr1 (1 HSPs)
chr1 (73-204)||(10010455-10010587)


Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 73 - 204
Target Start/End: Complemental strand, 10010587 - 10010455
Alignment:
73 agttcttcatgtactttctaaaaaatttgcttcgtattgtgtagatatgtgttgagaaaatcaataatttcatgttaacct-tttggtcttttgaaatgt 171  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
10010587 agttcttcatgtacttcctaaaaaatttgcttcgtattgtgtagatatgtgttgagaaaatcaataatttcatgttaacctctttggtcttttgaaatgt 10010488  T
172 agatatataggtcgattggaatcggcttctgtt 204  Q
    |||||||||||| ||||||||||||||||||||    
10010487 agatatataggttgattggaatcggcttctgtt 10010455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University