View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19570_low_28 (Length: 214)
Name: NF19570_low_28
Description: NF19570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19570_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 91 - 202
Target Start/End: Complemental strand, 2893196 - 2893085
Alignment:
| Q |
91 |
aaaacaatcctaaaggataatatgaaatatatgttataatcaatatctcaacagtactatgctttgcataattactcatgttaataggaatcactctatt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2893196 |
aaaacaatcctaaaggataatatgaaatatatgttataatcaatatctcaacagtactatgctttgcataattactcatgttaatagaaatcactctatt |
2893097 |
T |
|
| Q |
191 |
ttgtcacaggtt |
202 |
Q |
| |
|
||||| |||||| |
|
|
| T |
2893096 |
ttgtcgcaggtt |
2893085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 2895550 - 2895456
Alignment:
| Q |
1 |
agtgtacaagattatccctatgccatacctgtggttgttgggggaaacagcgagtgacttttccatttatcagcgaactatgagccatacaaaac |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2895550 |
agtgtacaagattatccctatgccatacctgtggttgttgggggcaacagcgagtgacttttccatttatcagcgaactatgagccatacaaaac |
2895456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University