View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19572_high_12 (Length: 217)
Name: NF19572_high_12
Description: NF19572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19572_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 27 - 202
Target Start/End: Complemental strand, 46587198 - 46587022
Alignment:
| Q |
27 |
agggatcaaacaatttttatccaaatttattagactaggannnnnnnn-aataacacaccggttaatgttggaattattagataataagattgaagttat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46587198 |
agggatcaaacaatttttatccaaatttattagactaggatttttttttaataacacaccggttaatgttggaattattagataataagattgaagttat |
46587099 |
T |
 |
| Q |
126 |
gttatgagtcctttaagttttaagttagtagagcccattctcttgtaacattttgacacatcataccatttgatatt |
202 |
Q |
| |
|
|| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46587098 |
gtcatgagtcctttaaattttaagttagtagagcccattctcttgtaacattttgacacatcataccatttgatatt |
46587022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University