View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19573_high_6 (Length: 381)
Name: NF19573_high_6
Description: NF19573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19573_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 30742517 - 30742445
Alignment:
| Q |
1 |
ttaagttagctaattgaagatgcatcaaaatgacccaaaagataagcatagttttctgcatacaagggaatgc |
73 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| || |||| || |||||| |
|
|
| T |
30742517 |
ttaagttagctgattgaagatgcatcaaaatgacccaaaagataagcatagctttttgaatactagtgaatgc |
30742445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University