View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19573_low_10 (Length: 276)
Name: NF19573_low_10
Description: NF19573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19573_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 55 - 272
Target Start/End: Original strand, 13147434 - 13147651
Alignment:
| Q |
55 |
ggtttaaccgaagatggaaagtctagtgttaatcttgtggagtcaacggtgttgatgtaaaaaagtttagtattaattcttatgnnnnnnntaaagaatg |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13147434 |
ggtttaaccgaagatggaaagtctagtgttaatcttgtggagtcaacggtattgatgtaaaaaagtttagtattaattcttatgaaaaaaataaagaatg |
13147533 |
T |
|
| Q |
155 |
tgatgcatttacatcaataattgttgacttcgcatgattaacactaggctttgcattttcaaatcaaacannnnnnngaaattataaatttttacctcaa |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||||||||||||||||||| || |
|
|
| T |
13147534 |
tgatgcatttacatcaataattgttgacttcgcatgattaacactagactttgcattttcaaatgaaacatttttttgaaattataaatttttaccttaa |
13147633 |
T |
|
| Q |
255 |
tgagttcttagacactac |
272 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
13147634 |
tgagttcttagacactac |
13147651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University