View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19573_low_11 (Length: 266)
Name: NF19573_low_11
Description: NF19573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19573_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 33492968 - 33492717
Alignment:
| Q |
1 |
agaaaactcaaaggtacatcaagaacaaagcacttcatcaagtttttcctgctcttctttaagcaaacaatgccacatgttttctaccatggaatgcaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33492968 |
agaaaactcaaaggtacatcaagaacaaagcacttcatcaagtttttcctgctcttctttaagcaaacaatgccacatgttttctaccacggaatgcaat |
33492869 |
T |
|
| Q |
101 |
gagctaaacaatgcaaaggctgaagctgaaagtgaaagttcattttccttcacacaaagtaaagattcatacatcgagtcgggtaataatgcattggatn |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33492868 |
gagctaaacaatgcaaaggctgaagctgaaagtgaaagttcagtttccttcacacaaagtaaagattcatacatcgagtcgggtaataatgcattggatg |
33492769 |
T |
|
| Q |
201 |
nnnnnnnnnnnnnnnntgaagtgagtttgaatgagttgcttcttgatgggaa |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33492768 |
aagaagaagaagatgatgaagtgagtttgaatgagttgcttcttgatgggaa |
33492717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University