View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19574_high_17 (Length: 307)

Name: NF19574_high_17
Description: NF19574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19574_high_17
NF19574_high_17
[»] chr3 (2 HSPs)
chr3 (158-285)||(51224210-51224337)
chr3 (1-88)||(51223925-51224012)


Alignment Details
Target: chr3 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 158 - 285
Target Start/End: Original strand, 51224210 - 51224337
Alignment:
158 ttatgtgtttgagttcagccagaagcatatacggtttgatattgctgtctgtaaatgcgcgtcaataatgatgttaaggaaatatattcgtatactgtct 257  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51224210 ttatgggtttgagttcagccagaagcatatacggtttgatattgctgtctgtaaatgcgcgtcaataatgatgttaaggaaatatattcgtatactgtct 51224309  T
258 cagaaatgacaatcctagtttcttaggc 285  Q
    ||||||||||||||||||||||||||||    
51224310 cagaaatgacaatcctagtttcttaggc 51224337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 51223925 - 51224012
Alignment:
1 atataaaatctataccgtcaaatatgataaaatgggcactgattggctgagcatgggattatgacatcacacaatccaaatcacttaa 88  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||    
51223925 atataaaatctataccgtcaaatatgataaaatgggcactggttggctgaccatgggattatgacatcacacaatccaaatcaattaa 51224012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University