View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19574_high_18 (Length: 306)
Name: NF19574_high_18
Description: NF19574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19574_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 44472485 - 44472718
Alignment:
| Q |
1 |
atcacctctcctaggtagaaaacaaattttttgtacaaaaggcatagactgaaggtggcagaggttgaaaagctcacccaaaatgcgagggaactagagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44472485 |
atcacctctcctaggtagaaaacaaattttttgtacaaaaggcatagactgaaggtggcagaggttgaaaagctcacccaaactgcgagggaactagagg |
44472584 |
T |
 |
| Q |
101 |
aggctgttcttgcagggggtgcagctgcaaatgctgtgagagattatcatcaaaaatttcaagaaatgctgtgggagaatggccggtggcattggaatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44472585 |
aggctgttcttgcagggggtgcagctgcaaatgctgtgagagattatcatcaaaaatttgaagaaatgttgtgggagaatggccggtggcattggaatct |
44472684 |
T |
 |
| Q |
201 |
taaatggcggatgaatttctttgagtgggaaaat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44472685 |
taaatggcggatgaatttctttgagtgggaaaat |
44472718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 44454314 - 44454480
Alignment:
| Q |
1 |
atcacctctcctaggtagaaaacaaattttttgtacaaaaggcatagactgaaggtggcagaggttgaaaagctcacccaaaatgcgagggaactagagg |
100 |
Q |
| |
|
||||||||||| ||| ||||||||| |||| | ||| || ||||||||||||||| ||||||||||||||||||||||||| | ||| |||||||||| |
|
|
| T |
44454314 |
atcacctctcccaggaggaaaacaaaattttgg-acagaatgcatagactgaaggtagcagaggttgaaaagctcacccaaacagtgagagaactagagg |
44454412 |
T |
 |
| Q |
101 |
aggctgttcttgcagggggtgcagctgcaaatgctgtgagagattatcatcaaaaatttcaagaaatg |
168 |
Q |
| |
|
|||| || |||||||||||||| ||||| |||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
44454413 |
aggcggtccttgcagggggtgctgctgcgaatgctgtgagagattatcagcgaaaatttcaagaaatg |
44454480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 42 - 149
Target Start/End: Original strand, 7518705 - 7518812
Alignment:
| Q |
42 |
gcatagactgaaggtggcagaggttgaaaagctcacccaaaatgcgagggaactagaggaggctgttcttgcagggggtgcagctgcaaatgctgtgaga |
141 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||| || ||||| ||||| |||||||| |||||||| ||||| ||||||||||| || ||| |
|
|
| T |
7518705 |
gcatagactaaaggtggcagaggttgaaaaactcacccaaactgttagggagctagaagaggctgtccttgcaggtggtgctgctgcaaatgcagttaga |
7518804 |
T |
 |
| Q |
142 |
gattatca |
149 |
Q |
| |
|
|||||||| |
|
|
| T |
7518805 |
gattatca |
7518812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 230 - 286
Target Start/End: Original strand, 44472428 - 44472484
Alignment:
| Q |
230 |
aaaatatatagtaagttgtcatcataacgatgtaaattttttgtacttggtatcacc |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44472428 |
aaaatatatagtaagttgtcatcataacgatgtaaattttttgtacttggtatcacc |
44472484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 230 - 286
Target Start/End: Original strand, 44454257 - 44454313
Alignment:
| Q |
230 |
aaaatatatagtaagttgtcatcataacgatgtaaattttttgtacttggtatcacc |
286 |
Q |
| |
|
|||||| | |||||||||| | ||||| |||| || ||||||||||||||||||||| |
|
|
| T |
44454257 |
aaaatacacagtaagttgttaccataatgatgaaacttttttgtacttggtatcacc |
44454313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 42 - 168
Target Start/End: Original strand, 11575007 - 11575133
Alignment:
| Q |
42 |
gcatagactgaaggtggcagaggttgaaaagctcacccaaaatgcgagggaactagaggaggctgttcttgcagggggtgcagctgcaaatgctgtgaga |
141 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| || |||||| ||||| ||| | || |||||||| |||||||| |||||||| || ||| |
|
|
| T |
11575007 |
gcatagacaaaaggtggcagaggttgaaaagctcacccaaactgtgagggagctagaagagtcagtccttgcaggtggtgcagcagcaaatgcagttaga |
11575106 |
T |
 |
| Q |
142 |
gattatcatcaaaaatttcaagaaatg |
168 |
Q |
| |
|
|||||||| | ||| ||||||||||| |
|
|
| T |
11575107 |
gattatcaacggaaagttcaagaaatg |
11575133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University