View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19574_high_20 (Length: 301)
Name: NF19574_high_20
Description: NF19574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19574_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 262; Significance: 1e-146; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 12 - 281
Target Start/End: Original strand, 44472215 - 44472484
Alignment:
| Q |
12 |
tagcataggtgattcatgtcattattttatctggtttgtttcttgcaaattgctaaacttcaagatgataacagagctttggatcatctagaactgttca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44472215 |
tagcataggtgattcatgtcattattttatctggtttgtttctttcaaattgctaaacttcaagatgataacagagctttggatcatctagaactgttca |
44472314 |
T |
|
| Q |
112 |
ggttgccttggccaaggcctccatggtggttgatctccaaaataataatcaagagctaatgaaacagattgggatttgccaggtttttgaaatattgttt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44472315 |
ggttgccttggccaaggcctccatggtggttgatctccaaaataataatcaagagctaatgaaacagattgggatttgctaggtttttgaaatattgttt |
44472414 |
T |
|
| Q |
212 |
gctattgtctttcaaaatatatagtaagttgtcatcataacgatgtaaattttttgtacttggtatcacc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44472415 |
gctattgtctttcaaaatatatagtaagttgtcatcataacgatgtaaattttttgtacttggtatcacc |
44472484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 106 - 281
Target Start/End: Original strand, 44454138 - 44454313
Alignment:
| Q |
106 |
tgttcaggttgccttggccaaggcctccatggtggttgatctccaaaataataatcaagagctaatgaaacagattgggatttgccaggtttttgaaata |
205 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||| ||||||||||||||||||| |||||||||||| ||| ||| |
|
|
| T |
44454138 |
tgttcaggttgccttggctaaggcctccatggtggatgatctccaaaataaaaatcaggagctaatgaaacagattgagatttgccaggtaattgcaatc |
44454237 |
T |
|
| Q |
206 |
ttgtttgctattgtctttcaaaatatatagtaagttgtcatcataacgatgtaaattttttgtacttggtatcacc |
281 |
Q |
| |
|
|| | || | || |||||||||||| | |||||||||| | ||||| |||| || ||||||||||||||||||||| |
|
|
| T |
44454238 |
ttttatgtttttctctttcaaaatacacagtaagttgttaccataatgatgaaacttttttgtacttggtatcacc |
44454313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 104 - 195
Target Start/End: Original strand, 7518495 - 7518586
Alignment:
| Q |
104 |
actgttcaggttgccttggccaaggcctccatggtggttgatctccaaaataataatcaagagctaatgaaacagattgggatttgccaggt |
195 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||| || ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7518495 |
actgttcaggttgccttggttaaggcctccatggtggatgatctccaaaacaaaaatcaagagctaatgaaacagattgagatttgccaggt |
7518586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 20 - 96
Target Start/End: Original strand, 44454013 - 44454091
Alignment:
| Q |
20 |
gtgattcatgtcattattttatctggtttgt--ttcttgcaaattgctaaacttcaagatgataacagagctttggatc |
96 |
Q |
| |
|
||||| ||||||||| ||||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
44454013 |
gtgatccatgtcattgttttatctggtttgtgtttcttgcagatagctaaacttcaagatgataacagagctttggatc |
44454091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 104 - 195
Target Start/End: Original strand, 11574804 - 11574895
Alignment:
| Q |
104 |
actgttcaggttgccttggccaaggcctccatggtggttgatctccaaaataataatcaagagctaatgaaacagattgggatttgccaggt |
195 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||| || ||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
11574804 |
actgttcagtttgccttggccaaggcctccatggtggatgatctccaaaacaaaaatcaagagctgatgaaacagattgagatttgccaggt |
11574895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 36 - 96
Target Start/End: Complemental strand, 636674 - 636614
Alignment:
| Q |
36 |
ttttatctggtttgtttcttgcaaattgctaaacttcaagatgataacagagctttggatc |
96 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
636674 |
ttttatctggtttgtttcttgcagattgctaaacttcaagatgataacagagctttagatc |
636614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University