View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19574_low_17 (Length: 307)
Name: NF19574_low_17
Description: NF19574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19574_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 158 - 285
Target Start/End: Original strand, 51224210 - 51224337
Alignment:
| Q |
158 |
ttatgtgtttgagttcagccagaagcatatacggtttgatattgctgtctgtaaatgcgcgtcaataatgatgttaaggaaatatattcgtatactgtct |
257 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51224210 |
ttatgggtttgagttcagccagaagcatatacggtttgatattgctgtctgtaaatgcgcgtcaataatgatgttaaggaaatatattcgtatactgtct |
51224309 |
T |
|
| Q |
258 |
cagaaatgacaatcctagtttcttaggc |
285 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
51224310 |
cagaaatgacaatcctagtttcttaggc |
51224337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 51223925 - 51224012
Alignment:
| Q |
1 |
atataaaatctataccgtcaaatatgataaaatgggcactgattggctgagcatgggattatgacatcacacaatccaaatcacttaa |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51223925 |
atataaaatctataccgtcaaatatgataaaatgggcactggttggctgaccatgggattatgacatcacacaatccaaatcaattaa |
51224012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University