View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19574_low_25 (Length: 246)
Name: NF19574_low_25
Description: NF19574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19574_low_25 |
 |  |
|
| [»] scaffold0562 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0562 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: scaffold0562
Description:
Target: scaffold0562; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 50 - 226
Target Start/End: Original strand, 6933 - 7110
Alignment:
| Q |
50 |
tgccttgcctttatctctctaccaacgttaatttagatggaaaagacatcgatcctatctttgatcaagctagaactgctgtttccacaatcataggaaa |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6933 |
tgccttgcctttatctctctaccaacgttaatttagatggaaaagacatcgatcctatctttgatcaagctagaactgctgtttccacaatcataggaaa |
7032 |
T |
 |
| Q |
150 |
accagacaaggtatgtctctcttttgattttgagtgttttacaaat-aaagcttgttgaatttggtttaaggttgtgt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7033 |
accagacaaggtatgtctctcttttgattttgagtgttttacaaataaaagcttgttgaatttggtttaaggttgtgt |
7110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 50 - 226
Target Start/End: Original strand, 3876114 - 3876291
Alignment:
| Q |
50 |
tgccttgcctttatctctctaccaacgttaatttagatggaaaagacatcgatcctatctttgatcaagctagaactgctgtttccacaatcataggaaa |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3876114 |
tgccttgcctttatctctctaccaacgttaatttagatggaaaagacatcgatcctatctttgatcaagctagaactgctgtttccacaatcataggaaa |
3876213 |
T |
 |
| Q |
150 |
accagacaaggtatgtctctcttttgattttgagtgttttacaaat-aaagcttgttgaatttggtttaaggttgtgt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3876214 |
accagacaaggtatgtctctcttttgattttgagtgttttacaaataaaagcttgttgaatttggtttaaggttgtgt |
3876291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University