View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19574_low_26 (Length: 230)
Name: NF19574_low_26
Description: NF19574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19574_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 217
Target Start/End: Original strand, 38617232 - 38617431
Alignment:
| Q |
18 |
aggtgggtaatgtaagctttgggttcaagaatcagtcagttctttgatccttcatactttatcnnnnnnnnnnnnnnnnnattctataaattttctaaca |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38617232 |
aggtgggtagtgtaagctttgggttcaagaatcagtcagttctttgatccttcatactttatctttttgttttcttttttattctataaattttctaaca |
38617331 |
T |
|
| Q |
118 |
tattactgtctctttcataaaaaataaataaactgtctctgtctttagaacctaaaaattgatggagttccttatttagagatataaaatgtgacatctg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38617332 |
tattactgtctctttcataaaaaataaataaactgtctctgtctttagaacctaaaaattgatggagttccttatttagagatataaaatgtgacatctg |
38617431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University