View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19574_low_27 (Length: 226)
Name: NF19574_low_27
Description: NF19574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19574_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 76 - 218
Target Start/End: Original strand, 12970136 - 12970282
Alignment:
| Q |
76 |
ggttcacaccgctccaatttcttactttgtttactaaaatatcttttat----gatcaagtgtctatccaaataaaaaggatttgtatattgtcttttct |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12970136 |
ggttcacaccgctccaatttcttactttgtttactaaaatatcttttattatcaatcaagtgtctatccaaataaaaaggacttgtatattgtcttttct |
12970235 |
T |
 |
| Q |
172 |
tgcatacataagacaattacaacaaactaatatttaattagtattat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12970236 |
tgcatacataagacaattacaacaaactaatatttaattaatattat |
12970282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 12970028 - 12970105
Alignment:
| Q |
1 |
attgggaggttgaccagatttgggtaccattttcgcacgaagggagggaatttgaatggaaaaatattaagcaatggt |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12970028 |
attgggaggttgaccagatttgggtaccattttcgcacgcagggagggaatttgaatggaaaaatattaatcaatggt |
12970105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University