View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19575_high_16 (Length: 266)
Name: NF19575_high_16
Description: NF19575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19575_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 15062461 - 15062293
Alignment:
| Q |
1 |
caaatgagcatacaatgtattgtaatactagtactagtaacttagaggttactcattatagatacaatgaatgattatgtttatttttatttttaacaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
15062461 |
caaatgagcatacaatgtattgtaatactggta------acttagaggttactcattatagatacaatgaatgattctttttatttttatttttgacaaa |
15062368 |
T |
 |
| Q |
101 |
agatacaatgaatgataaatctgtcgagttcctcctcctaaattatactttaaattgtgtgaacagtacatcaaa |
175 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||| |||||||||| |||||||| ||||||| |
|
|
| T |
15062367 |
agatacaatgaatgataaattcgttaagttcctcctcctaaattatattttaaattgtatgaacagttcatcaaa |
15062293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 199 - 258
Target Start/End: Complemental strand, 15061312 - 15061253
Alignment:
| Q |
199 |
atattggactaaacatattaatctatgataatgctcttcatcaaatgccaaatattcttc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
15061312 |
atattggactaaacatattaatctatgaaaatgctattcatcaaatgcctaatattcttc |
15061253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 177 - 214
Target Start/End: Complemental strand, 15061365 - 15061328
Alignment:
| Q |
177 |
ttgttagttcaacacatattttatattggactaaacat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15061365 |
ttgttagttcaacacatattttatattggactaaacat |
15061328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University