View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19576_high_22 (Length: 271)
Name: NF19576_high_22
Description: NF19576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19576_high_22 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 36686663 - 36686917
Alignment:
| Q |
18 |
gcttcgaaattcatatggggtctgttgaaataagaaaataaa-----ataaggttaatcgcaatgtttagtctgtgtataatttcagttcggatggaaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
36686663 |
gcttcgaaattcatatggggtctgttgaaataagaaaataaattaaaataaggttaatcgcaatgtttagtcagtgtataatttgagttcggatggaaga |
36686762 |
T |
|
| Q |
113 |
gggatattttag------nnnnnnnnnnnnngggtggatcgtggcccatctgaaccctaaagtaacatgctttagggagctaaaattatatgtatnnnnn |
206 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36686763 |
gggatattttagtaatttttttttttttttttggtgggtcgtggcccatctaaaccctaaagtaacatg-tttagggagctaaaattatatgta------ |
36686855 |
T |
|
| Q |
207 |
nnnnnnntagaataccatactttggaattgatgaggtatagactaagtgcttcaattttgtaagc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36686856 |
---aaaatagaataccatactttggaattgatgaggtatagactaagtgcttcaattttgtaagc |
36686917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University