View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19576_high_34 (Length: 203)
Name: NF19576_high_34
Description: NF19576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19576_high_34 |
 |  |
|
| [»] scaffold1749 (1 HSPs) |
 |  |  |
|
| [»] scaffold0428 (1 HSPs) |
 |  |  |
|
| [»] scaffold0363 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 1e-64; HSPs: 10)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 10 - 190
Target Start/End: Complemental strand, 12177493 - 12177313
Alignment:
| Q |
10 |
gacatcatcaaagtagtttcccaaaatctgaatcaaaagtataccaatgaacttagatgtttgttcataccagatgaaaactattcaagcattgaatcat |
109 |
Q |
| |
|
||||||||||||| ||| |||||| |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12177493 |
gacatcatcaaagcagtcctccaaaaattgaatcaaaagtatacaaatgaacttagatgcttgttcataccagatgaaaactattcaagcattgaatcat |
12177394 |
T |
 |
| Q |
110 |
tattaaaaaatgattcaagcgaggttagaactattggaatttggggcatgggaggtataggaaagacaacccttgctgctg |
190 |
Q |
| |
|
|||||||| |||||||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12177393 |
tattaaaagtagattcaagagaagttagaactattggaatttggggcatgggaggcataggaaagacaacccttgctgctg |
12177313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 10 - 190
Target Start/End: Complemental strand, 12188814 - 12188634
Alignment:
| Q |
10 |
gacatcatcaaagtagtttcccaaaatctgaatcaaaagtataccaatgaacttagatgtttgttcataccagatgaaaactattcaagcattgaatcat |
109 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||||||||||| ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12188814 |
gacatcatcaaagcagttctccaaaaattgaatcaaaagtatacaaatgagcttagatgtttgttcataccagatgaagactattcaagcattgaatcat |
12188715 |
T |
 |
| Q |
110 |
tattaaaaaatgattcaagcgaggttagaactattggaatttggggcatgggaggtataggaaagacaacccttgctgctg |
190 |
Q |
| |
|
| |||||| |||| ||||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12188714 |
ttttaaaagatgactcaagagaagttagaactattggaatttggggcatgggaggcataggaaagacaacccttgctgctg |
12188634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 10 - 190
Target Start/End: Complemental strand, 12421921 - 12421741
Alignment:
| Q |
10 |
gacatcatcaaagtagtttcccaaaatctgaatcaaaagtataccaatgaacttagatgtttgttcataccagatgaaaactattcaagcattgaatcat |
109 |
Q |
| |
|
||||||||||||| ||| |||||| |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12421921 |
gacatcatcaaagcagtcctccaaaaattgaatcaaaagtatacaaatgaacttagatgcttgttcataccagatgaaaactattcaagcattgaatcat |
12421822 |
T |
 |
| Q |
110 |
tattaaaaaatgattcaagcgaggttagaactattggaatttggggcatgggaggtataggaaagacaacccttgctgctg |
190 |
Q |
| |
|
|||||||| |||||||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12421821 |
tattaaaagtagattcaagagaagttagaactattggaatttggggcatgggaggcataggaaagacaacccttgctgctg |
12421741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 10 - 190
Target Start/End: Complemental strand, 12433242 - 12433062
Alignment:
| Q |
10 |
gacatcatcaaagtagtttcccaaaatctgaatcaaaagtataccaatgaacttagatgtttgttcataccagatgaaaactattcaagcattgaatcat |
109 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||||||||||| ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12433242 |
gacatcatcaaagcagttctccaaaaattgaatcaaaagtatacaaatgagcttagatgtttgttcataccagatgaagactattcaagcattgaatcat |
12433143 |
T |
 |
| Q |
110 |
tattaaaaaatgattcaagcgaggttagaactattggaatttggggcatgggaggtataggaaagacaacccttgctgctg |
190 |
Q |
| |
|
| |||||| |||| ||||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12433142 |
ttttaaaagatgactcaagagaagttagaactattggaatttggggcatgggaggcataggaaagacaacccttgctgctg |
12433062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 142 - 180
Target Start/End: Complemental strand, 6062778 - 6062740
Alignment:
| Q |
142 |
attggaatttggggcatgggaggtataggaaagacaacc |
180 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6062778 |
attggaatttggggcatgggaggaataggaaagacaacc |
6062740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 142 - 190
Target Start/End: Original strand, 32633309 - 32633357
Alignment:
| Q |
142 |
attggaatttggggcatgggaggtataggaaagacaacccttgctgctg |
190 |
Q |
| |
|
|||||| ||||||||||||| || ||||| ||||||||||||||||||| |
|
|
| T |
32633309 |
attggactttggggcatggggggcataggtaagacaacccttgctgctg |
32633357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 143 - 180
Target Start/End: Complemental strand, 6071863 - 6071826
Alignment:
| Q |
143 |
ttggaatttggggcatgggaggtataggaaagacaacc |
180 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
6071863 |
ttggaatttggggcatgggcggtatgggaaagacaacc |
6071826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 185
Target Start/End: Original strand, 5549762 - 5549874
Alignment:
| Q |
73 |
ttcataccagatgaaaactattcaagcattgaatcattattaaaaaatgattcaagcgaggttagaactattggaatttggggcatgggaggtataggaa |
172 |
Q |
| |
|
|||||||| |||||||||||| |||||| |||| ||| ||||| |||||||| || ||| || |||||| ||||||| |||||||| || || | |
|
|
| T |
5549762 |
ttcatacctgatgaaaactatcggagcattcaatctttaataaaatttgattcaacagaagttcaaatcattggagtttggggtatgggaggcattggta |
5549861 |
T |
 |
| Q |
173 |
agacaacccttgc |
185 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5549862 |
agacaacccttgc |
5549874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 190
Target Start/End: Complemental strand, 6310529 - 6310481
Alignment:
| Q |
142 |
attggaatttggggcatgggaggtataggaaagacaacccttgctgctg |
190 |
Q |
| |
|
|||||| ||||||| |||||||| | ||| ||||||||||||||||||| |
|
|
| T |
6310529 |
attggactttggggtatgggaggcacaggtaagacaacccttgctgctg |
6310481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 186
Target Start/End: Original strand, 14404759 - 14404803
Alignment:
| Q |
142 |
attggaatttggggcatgggaggtataggaaagacaacccttgct |
186 |
Q |
| |
|
|||||||||||||| |||||||| | ||| ||||||||||||||| |
|
|
| T |
14404759 |
attggaatttggggtatgggaggcacaggtaagacaacccttgct |
14404803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 143 - 186
Target Start/End: Complemental strand, 23455203 - 23455160
Alignment:
| Q |
143 |
ttggaatttggggcatgggaggtataggaaagacaacccttgct |
186 |
Q |
| |
|
||||||| ||||||||||| || ||||||||||||||||||||| |
|
|
| T |
23455203 |
ttggaatatggggcatgggtggcataggaaagacaacccttgct |
23455160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 186
Target Start/End: Complemental strand, 33264746 - 33264700
Alignment:
| Q |
140 |
ctattggaatttggggcatgggaggtataggaaagacaacccttgct |
186 |
Q |
| |
|
|||| ||||||||||| |||||||| ||||| ||||||||||||||| |
|
|
| T |
33264746 |
ctataggaatttgggggatgggaggaatagggaagacaacccttgct |
33264700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 186
Target Start/End: Complemental strand, 33412050 - 33412004
Alignment:
| Q |
140 |
ctattggaatttggggcatgggaggtataggaaagacaacccttgct |
186 |
Q |
| |
|
||||||||||||| || ||||| || ||||||||||||||||||||| |
|
|
| T |
33412050 |
ctattggaatttgtggaatgggcggaataggaaagacaacccttgct |
33412004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 186
Target Start/End: Original strand, 17438811 - 17438857
Alignment:
| Q |
140 |
ctattggaatttggggcatgggaggtataggaaagacaacccttgct |
186 |
Q |
| |
|
|||| ||||||||||| |||||||| ||||| ||||||||||||||| |
|
|
| T |
17438811 |
ctataggaatttgggggatgggaggaatagggaagacaacccttgct |
17438857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1749 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold1749
Description:
Target: scaffold1749; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 145 - 186
Target Start/End: Complemental strand, 91 - 50
Alignment:
| Q |
145 |
ggaatttggggcatgggaggtataggaaagacaacccttgct |
186 |
Q |
| |
|
||||||||||| |||||||| ||||| ||||||||||||||| |
|
|
| T |
91 |
ggaatttgggggatgggaggaatagggaagacaacccttgct |
50 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0428 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0428
Description:
Target: scaffold0428; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 145 - 186
Target Start/End: Complemental strand, 8852 - 8811
Alignment:
| Q |
145 |
ggaatttggggcatgggaggtataggaaagacaacccttgct |
186 |
Q |
| |
|
||||||||||| |||||||| ||||| ||||||||||||||| |
|
|
| T |
8852 |
ggaatttgggggatgggaggaatagggaagacaacccttgct |
8811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0363 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0363
Description:
Target: scaffold0363; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 186
Target Start/End: Complemental strand, 14094 - 14050
Alignment:
| Q |
142 |
attggaatttggggcatgggaggtataggaaagacaacccttgct |
186 |
Q |
| |
|
|||||||||||||| |||||||| | ||| ||||||||||||||| |
|
|
| T |
14094 |
attggaatttggggtatgggaggcacaggtaagacaacccttgct |
14050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University