View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19577_low_5 (Length: 371)
Name: NF19577_low_5
Description: NF19577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19577_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 8e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 18 - 115
Target Start/End: Original strand, 29235857 - 29235954
Alignment:
| Q |
18 |
aatgggaactggtggtttggatatggaactgaaatagttgggtattggccatcctctttgttcacacagttcaatgataatgcacatgcaattcagtt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29235857 |
aatgggaactggtggtttggatatggaactgaaatagttgggtattggccatcctctttattcacacagttcaatgataatgcacatgcaattcagtt |
29235954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 18 - 115
Target Start/End: Original strand, 29280590 - 29280687
Alignment:
| Q |
18 |
aatgggaactggtggtttggatatggaactgaaatagttgggtattggccatcctctttgttcacacagttcaatgataatgcacatgcaattcagtt |
115 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||||| || ||||||||| |||| || ||||||||||||| |||| |||| |
|
|
| T |
29280590 |
aatgggaactggtggtttggatatggatctgaagtagttgggtattggccatcttccttgttcacaaagttgaaggataatgcacatgaaattgagtt |
29280687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 55 - 95
Target Start/End: Original strand, 40030312 - 40030352
Alignment:
| Q |
55 |
ttgggtattggccatcctctttgttcacacagttcaatgat |
95 |
Q |
| |
|
|||| |||||||||||||||||||||||||| || |||||| |
|
|
| T |
40030312 |
ttggatattggccatcctctttgttcacacacttaaatgat |
40030352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University