View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19578_low_10 (Length: 228)
Name: NF19578_low_10
Description: NF19578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19578_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 7910479 - 7910689
Alignment:
| Q |
1 |
atatactgggaacgatagaatgcctactgttcgcttctaagataccttgaacatcaaaatggctattgttctagagtacattgatatactagaaacgaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7910479 |
atatactgggaacgatagaatgcctactgttcgcttctaagataccttgaacatcaaaatggctattgttctagagtacattgatatactagaaacgaca |
7910578 |
T |
|
| Q |
101 |
aactgacacttttcgagaaaaatggagataaaattgggagaaccagttttcaaatcagtgttgagtaggtttagcgattttccgtatcgaatcgggacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7910579 |
aactgacacttttcgagaaaaatggagataaaattgggagaaccagttttcaaatcagtgttgagtaggtttagcgattttccgtatcgaatcgggacaa |
7910678 |
T |
|
| Q |
201 |
cctctaaaact |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
7910679 |
cctctaaaact |
7910689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University