View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19578_low_5 (Length: 369)
Name: NF19578_low_5
Description: NF19578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19578_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 6e-56; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 180 - 310
Target Start/End: Original strand, 12644870 - 12645000
Alignment:
| Q |
180 |
cttgagtagaacaattcttgcacaaactttacttacctcttgacaaaacttcagatcatcagagctccttttccctagaaaccggaggattaacacaaaa |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
12644870 |
cttgagtagaacaattcttgcacaaactttacttacctcttggcaaaacttcagatcatcagggctcctttcccctagagaccgaaggattaacacaaaa |
12644969 |
T |
 |
| Q |
280 |
tatatacatttctcgtataatagttccaatt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
12644970 |
tatatacatttctcgtataatagttccaatt |
12645000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 317 - 353
Target Start/End: Original strand, 12646648 - 12646684
Alignment:
| Q |
317 |
tataaaactaaatacaccaataaatcatgcaatattt |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12646648 |
tataaaactaaatacaccaataaatcatgcaatattt |
12646684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 12 - 59
Target Start/End: Original strand, 12644778 - 12644825
Alignment:
| Q |
12 |
aatactaatactagttgttgcaaaatttgatgagaagagaagtgaaaa |
59 |
Q |
| |
|
||||||| ||||||||||||||||||||||| | ||||||||| |||| |
|
|
| T |
12644778 |
aatactattactagttgttgcaaaatttgataaaaagagaagtaaaaa |
12644825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 221
Target Start/End: Original strand, 18953194 - 18953227
Alignment:
| Q |
188 |
gaacaattcttgcacaaactttacttacctcttg |
221 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
18953194 |
gaacaattcttgcccaaactttacttacctcttg |
18953227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 221
Target Start/End: Original strand, 39634347 - 39634388
Alignment:
| Q |
180 |
cttgagtagaacaattcttgcacaaactttacttacctcttg |
221 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
39634347 |
cttgagtagaacaatttttggtcaaactttacttacctcttg |
39634388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University