View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19578_low_7 (Length: 298)
Name: NF19578_low_7
Description: NF19578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19578_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 18 - 284
Target Start/End: Original strand, 40741299 - 40741565
Alignment:
| Q |
18 |
aaatctaccttattacgagccattgcaggtctctaagaacgttttctttgttcttttttactaaacatctcaaaagatattcacatttgtatttaggtaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40741299 |
aaatctaccttattacgagccattgcaggtctctaagaacgttttctttgttcctttttactaaacatctcaaaagatattcacatttgtatttaggtaa |
40741398 |
T |
|
| Q |
118 |
tcaaagctaaaatggatctttctctttacctcaggaagattgcatccttcagctaggatgtatggtgaagtgtttgtgaacggggcgaaatcgcaaatgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40741399 |
tcaaagctaaaatggatctttctctttacctcaggaagattgcatccttcagctaggatgtatggtgaagtgtttgtgaacggggcgaaatcgcaaatgc |
40741498 |
T |
|
| Q |
218 |
catatggatcatacgtgagttcagtgcctcattgattgtttaatatctgaatttccattatgtcatg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40741499 |
catatggatcatacgtgagttcagtgcctcattgattgtttaatatctgaatttccattatgtcatg |
40741565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University