View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1957_high_23 (Length: 269)
Name: NF1957_high_23
Description: NF1957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1957_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 245
Target Start/End: Complemental strand, 6062481 - 6062253
Alignment:
| Q |
16 |
atcctaaaactagtggcccaaaataagatttatcgaataaagaactaaacccatcgcaagaatatgattaacttggaatttgaagaaaatagggttaggg |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6062481 |
atcctaaaactaatggcccaaaataagatttatcgaataaagaactaaacccatcacaagaatatgattaacttggaatttgaagaaaatagggttaggg |
6062382 |
T |
 |
| Q |
116 |
tttgaaataaaaatcgagactttttatttaatggtggaatctgattagttcactaacccgaataggagcagagtggtggcggcggggtgtggtggttccg |
215 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6062381 |
tt-gaaataaaaatcgagactttttatttaatggtggaatctgattagttcactaacccgaataggagcagagtggtggcggcggggtgtggtggttccg |
6062283 |
T |
 |
| Q |
216 |
tcgcaaactgtgatggaacaaaaataaaac |
245 |
Q |
| |
|
||||||||||||||||||| |||||||||| |
|
|
| T |
6062282 |
tcgcaaactgtgatggaaccaaaataaaac |
6062253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University