View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1957_low_22 (Length: 283)
Name: NF1957_low_22
Description: NF1957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1957_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 275; Significance: 1e-154; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 19854702 - 19854980
Alignment:
| Q |
1 |
taatgatggttcaaaaactagcaagggtggtattattgttgataatgatgttccttctgttcaagatggtgatggtatgaaagctggggaaaatattgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19854702 |
taatgatggttcaaaaactagcaagggtggtattattgttgataatgatgttccttctgttcaagatggtgatggtatgaaagctggggaaaatattgct |
19854801 |
T |
|
| Q |
101 |
gctgatgggggaaataatgttgttgatgacgttccttctgttcaagatggtatgaaagctgggggaaatattgatgctgatgggggaaattttgatgatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19854802 |
gctgatgggggaaataatgttgttgatgacgttccttctgttcaagatggtatgaaagctgggggaaatattgatgctgatgggggaaattttgatgatg |
19854901 |
T |
|
| Q |
201 |
acgttgcttctgttcaagatggtatgaaaattgggggaaatattgatgttgacggcggaaatgttgttgctgatgatgt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19854902 |
acgttgcttctgttcaagatggtatgaaaattgggggaaatattgatgttgatggcggaaatgttgttgctgatgatgt |
19854980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 8 - 55
Target Start/End: Original strand, 19854433 - 19854480
Alignment:
| Q |
8 |
ggttcaaaaactagcaagggtggtattattgttgataatgatgttcct |
55 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||| ||||||||||| |
|
|
| T |
19854433 |
ggttcaaaaactagcaagggtgataatattgttgatgatgatgttcct |
19854480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 3 - 59
Target Start/End: Original strand, 19854575 - 19854631
Alignment:
| Q |
3 |
atgatggttcaaaaactagcaagggtggtattattgttgataatgatgttccttctg |
59 |
Q |
| |
|
||||||||| ||||||| |||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
19854575 |
atgatggttttaaaactaacaagggtgataatattgttgatgatgatgttccttctg |
19854631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 71 - 140
Target Start/End: Original strand, 19854919 - 19854988
Alignment:
| Q |
71 |
gatggtatgaaagctggggaaaatattgctgctgatgggggaaataatgttgttgatgacgttccttctg |
140 |
Q |
| |
|
|||||||||||| ||||| |||||||| || |||||| |||||| ||||| |||||| |||||||||| |
|
|
| T |
19854919 |
gatggtatgaaaattgggggaaatattgatgttgatggcggaaatgttgttgctgatgatgttccttctg |
19854988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 109 - 201
Target Start/End: Complemental strand, 22688568 - 22688476
Alignment:
| Q |
109 |
gggaaataatgttgttgatgacgttccttctgttcaagatggtatgaaagctgggggaaatattgatgctgatgggggaaattttgatgatga |
201 |
Q |
| |
|
|||||||| ||||| ||||| |||| || ||||||| |||||||||||| |||||||||||||||| ||||| || ||||| ||| |||||| |
|
|
| T |
22688568 |
gggaaatattgttgacgatgatgttcgttttgttcaatatggtatgaaagttgggggaaatattgatcctgattggagaaatattgttgatga |
22688476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 3 - 62
Target Start/End: Complemental strand, 22688647 - 22688588
Alignment:
| Q |
3 |
atgatggttcaaaaactagcaagggtggtattattgttgataatgatgttccttctgttc |
62 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||| ||||||| |||||||||||||| |
|
|
| T |
22688647 |
atgatggttcaaaatctagcaagggtggtaatactgtcgataatgttgttccttctgttc |
22688588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 211 - 247
Target Start/End: Complemental strand, 22688538 - 22688502
Alignment:
| Q |
211 |
tgttcaagatggtatgaaaattgggggaaatattgat |
247 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
22688538 |
tgttcaatatggtatgaaagttgggggaaatattgat |
22688502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University