View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19580_high_13 (Length: 387)
Name: NF19580_high_13
Description: NF19580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19580_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 1 - 369
Target Start/End: Original strand, 50885447 - 50885815
Alignment:
| Q |
1 |
tccaacaaagacattgcttcaggaagcaaatcattccaggaagtggaggaggatttcatgtaaacattggttattggcttatagacaaatgactggtggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50885447 |
tccaacaaagacattgcttcaggaagcagatcattccaggaagtggaggaggatttcatgtaaacattggttattggcttatagacaaatgactggtggt |
50885546 |
T |
|
| Q |
101 |
caacttgctgccatgattaaataacccaactggaatctgaaactgcatcattgtcttggttaaggaaaccaagtggtgtgtgtacccaactgtgatttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50885547 |
caacttgctgccatgattaaataacccaactggaatctgaaactgcatcattgtcttggttaaggaaaccaagtggtgtgtgtacccaactgtgatttag |
50885646 |
T |
|
| Q |
201 |
ggataaaggagaatataaaatagggaggggagaatgcaatgattggttttcataccttgtgatggttatatacctgatttataactttgcttgtgacaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50885647 |
ggataaaggagaatataaaatagggaggggagaatgcaatgattggttttcataccttgtgatggttatatacctgatttataactttgcttgtgacaat |
50885746 |
T |
|
| Q |
301 |
ggtttttattttattttctcacagtcgagtcaaaaactgatgtttcttgctataattttgagtcttgtt |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50885747 |
ggtttttattttattttctcacagtcgagtcaaaaactgatgtttcttgctataattttgagtcttgtt |
50885815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University