View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19580_high_27 (Length: 270)
Name: NF19580_high_27
Description: NF19580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19580_high_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 67 - 212
Target Start/End: Original strand, 41984415 - 41984560
Alignment:
| Q |
67 |
tacataattgatgatatagggttgataattgttgattnnnnnnntatatagcataattgataattgatgatttattcatctaataatgatgttgataatt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41984415 |
tacataattgatgatatagggttgataattgttgattaaaaaaatatatagcataattgataattgatgatttattcatctaataatgatgttgataatt |
41984514 |
T |
|
| Q |
167 |
gttgattatatgctatgcttattttgttgttaatgattcattatga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41984515 |
gttgattatatgctatgcttattttgttgttaatgattcattatga |
41984560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 16 - 68
Target Start/End: Original strand, 41984185 - 41984237
Alignment:
| Q |
16 |
atagtcatctcaactaagtttgatatcaaattctaaagcattagtcacatcta |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41984185 |
atagtcatctcaactaagtttgatatcaaattctaaagcattagtcacatcta |
41984237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University