View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19580_high_31 (Length: 253)

Name: NF19580_high_31
Description: NF19580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19580_high_31
NF19580_high_31
[»] chr4 (1 HSPs)
chr4 (142-236)||(2155093-2155189)


Alignment Details
Target: chr4 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 142 - 236
Target Start/End: Complemental strand, 2155189 - 2155093
Alignment:
142 cctgattaaacatacccatatttgtttatctacttttagtgctgaatgaataacaaacggggca--tataaatgacatagtgtgtggacatgtctag 236  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||||||||||    
2155189 cctgattaaacatacccatatttgtttatctacttttagtgctgaatgaataataaacggggcatatataaatgacatagtgtgtggacatgtctag 2155093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University