View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19580_high_37 (Length: 210)
Name: NF19580_high_37
Description: NF19580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19580_high_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 8165531 - 8165352
Alignment:
| Q |
17 |
aacaccaaccagagcttaaatttgtttatgtttctattctaggtggatcgtaacaaatagttttgactgataaattgtttttgatttt-gaaactacaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
8165531 |
aacaccaaccagagcttaaatttgtttaagtttctattctaggtgggtcgtaacaaataggtttgactgataaattgtttttgatttttgaaaatacaat |
8165432 |
T |
 |
| Q |
116 |
taccttattaatttgtaccataatttggtctacatgaaatcgacaggcttgtaatctcttctatcaataaacagaattat |
195 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8165431 |
taccctattaatttgtaccataatttggtctatatgaaatcgacaggcttgtaatctcttccatcaataaacagaattat |
8165352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University