View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19580_high_37 (Length: 210)

Name: NF19580_high_37
Description: NF19580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19580_high_37
NF19580_high_37
[»] chr2 (1 HSPs)
chr2 (17-195)||(8165352-8165531)


Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 8165531 - 8165352
Alignment:
17 aacaccaaccagagcttaaatttgtttatgtttctattctaggtggatcgtaacaaatagttttgactgataaattgtttttgatttt-gaaactacaat 115  Q
    |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||| ||||||    
8165531 aacaccaaccagagcttaaatttgtttaagtttctattctaggtgggtcgtaacaaataggtttgactgataaattgtttttgatttttgaaaatacaat 8165432  T
116 taccttattaatttgtaccataatttggtctacatgaaatcgacaggcttgtaatctcttctatcaataaacagaattat 195  Q
    |||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||    
8165431 taccctattaatttgtaccataatttggtctatatgaaatcgacaggcttgtaatctcttccatcaataaacagaattat 8165352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University