View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19580_low_25 (Length: 281)
Name: NF19580_low_25
Description: NF19580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19580_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 6 - 261
Target Start/End: Original strand, 19175696 - 19175952
Alignment:
| Q |
6 |
aagattcacaacgtaacaactttgcgtttgcaaccccaaaattcaaaaccataaattgcattcaaaatttgaaattgaagnnnnnnnn-gataggcacag |
104 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
19175696 |
aagattcacaacgtaacaactttgctttcgcaaccccaaaattcaaaaccataaattgcattcaaaatttgaaattgaagaaaaaaaaagataggcatag |
19175795 |
T |
|
| Q |
105 |
tagtatgtcatatacctataaaatcggtaataatgcggccatctgagaatcgtccggtgggtttatcgaaaaccccattttgtccatatggtttacaatc |
204 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19175796 |
cagtatgttatatacctataaaatcggtaataacgcggccatctgagaatcgtccggtgggtttatcgaaaaccccattttgtccatatggtttacaatc |
19175895 |
T |
|
| Q |
205 |
tgctttgttctcaggaatagtatctatatagttgttgttgccagaatcaacagtaga |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19175896 |
tgctttgttctcaggaatagtatctatatagttgttgttgccagaatcaacagtaga |
19175952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University