View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19580_low_26 (Length: 275)
Name: NF19580_low_26
Description: NF19580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19580_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 2 - 268
Target Start/End: Complemental strand, 54395513 - 54395247
Alignment:
| Q |
2 |
gttcaataaagcagctacaccaatgagtgccgtggcattaaccttagcacactacaaagaagtatacctatccatcactcaatcaagatgattctcacta |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54395513 |
gttcaataaagcagctacaccaatgagtgccgtggcattaaccttagcacactacaaagaagtatacctatccatcactcaatcaagatgattctcacta |
54395414 |
T |
|
| Q |
102 |
atttcaatgttacatatgccaccattgcgcacatacaaaatcagttcaaaattctacaacgcacgactaacctcatatatgtgctttaatcagttatgta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
54395413 |
atttcaatgttacatatgccaccattgcgcacatacaaaatcagttcaaaattctacaacgcacgactaacctcatatatgtgcattaatcagttatgta |
54395314 |
T |
|
| Q |
202 |
gcttctctatgctttccaacaacatctctgcatccactactaaactctctgattctaccctttgctt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54395313 |
gcttctctatgctttccaacaacatctctgcatccactactaaactctctgattctaccctttgctt |
54395247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University