View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19580_low_30 (Length: 263)
Name: NF19580_low_30
Description: NF19580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19580_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 46 - 246
Target Start/End: Original strand, 33673645 - 33673845
Alignment:
| Q |
46 |
atatatatgctcaatacgtgtaccattattgtctaagcaacttattacgacttatcaaattaagttttatgatacgtgtttacgcacaaatatttttatt |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33673645 |
atatatatgctcaatacgtgtaccattattgtctaagcaacttattacgacttatcaaattaagttttatgatacgtgtttacgcac-aatatttttatt |
33673743 |
T |
 |
| Q |
146 |
agac-nnnnnnngggtgagattcttattaaacttttattatatgaatccaggaatttctctccagagtgacaactaacaaatgattgaaatcatatagag |
244 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
33673744 |
agacttttttttgggtgagattcttattaaatttttattatatgaatccaggaatttctctccagagtgacaactgacatatgattgaaatcatatagag |
33673843 |
T |
 |
| Q |
245 |
tg |
246 |
Q |
| |
|
|| |
|
|
| T |
33673844 |
tg |
33673845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 9 - 49
Target Start/End: Original strand, 33673582 - 33673622
Alignment:
| Q |
9 |
gattattctatcaacaaaaacacttttcttcacttctatat |
49 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33673582 |
gatttttctatcaacaaaaacacttttcttcacttctatat |
33673622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University