View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19580_low_39 (Length: 202)
Name: NF19580_low_39
Description: NF19580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19580_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 5e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 61 - 184
Target Start/End: Original strand, 5507595 - 5507718
Alignment:
| Q |
61 |
agacaagttgcattatatgtgtatcatacacacttaatttaattggcttattcacattgtaatttttgtgttcctaggatatttccacccttgagccaaa |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5507595 |
agacaagttgcattatatgtgtatcatacacacttaatttaattggcttattcacattgtaatttttgtgttcctaggatatttccacccttgagccaaa |
5507694 |
T |
 |
| Q |
161 |
tattaataccctttgtgaatctag |
184 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5507695 |
tattaataccctttgtgaatctag |
5507718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 17 - 76
Target Start/End: Original strand, 5507514 - 5507573
Alignment:
| Q |
17 |
atcaatttacataacaagctagtacatcagaatggaaatattaaagacaagttgcattat |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5507514 |
atcaatttacataacaagctagtacatcagaatggaaatattaaagacaagttgcattat |
5507573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University