View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19581_low_9 (Length: 270)
Name: NF19581_low_9
Description: NF19581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19581_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 252
Target Start/End: Original strand, 52298754 - 52298987
Alignment:
| Q |
19 |
agtggacgagagggagaaggtggtgaggcacatgtgggatgtgtacactcgcagtcatagcaactccattggattacctcagttttggttggaagctttt |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52298754 |
agtggaggagagggagaaggtggtgaggcacatgtgggatgtgtacactcgcagtcatagcaactccattggattacctcagttttggttggaagctttt |
52298853 |
T |
|
| Q |
119 |
gaagctgcttatgagcacttggtcagtgatgttccagcagttcgagacgccgctgttttagaaatcgccaaagatgtcactggcactgcgctcacacatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52298854 |
gaagctgcttatgagcacttggtcagtgatgttccagcagttcgagacgccgctgtttcagaaatcgccaaagatgtcactggcaccgcgctcacacatt |
52298953 |
T |
|
| Q |
219 |
ttacaccaacttcctcttcaacttcaatcaccac |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
52298954 |
ttacaccaacttcctcttcaacttcaatcaccac |
52298987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 66
Target Start/End: Original strand, 7550006 - 7550051
Alignment:
| Q |
21 |
tggacgagagggagaaggtggtgaggcacatgtgggatgtgtacac |
66 |
Q |
| |
|
|||| ||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
7550006 |
tggaggagagggagaaagtggtgaggcatatgtgggatgtgtacac |
7550051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University