View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19581_low_9 (Length: 270)

Name: NF19581_low_9
Description: NF19581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19581_low_9
NF19581_low_9
[»] chr3 (1 HSPs)
chr3 (19-252)||(52298754-52298987)
[»] chr5 (1 HSPs)
chr5 (21-66)||(7550006-7550051)


Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 252
Target Start/End: Original strand, 52298754 - 52298987
Alignment:
19 agtggacgagagggagaaggtggtgaggcacatgtgggatgtgtacactcgcagtcatagcaactccattggattacctcagttttggttggaagctttt 118  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52298754 agtggaggagagggagaaggtggtgaggcacatgtgggatgtgtacactcgcagtcatagcaactccattggattacctcagttttggttggaagctttt 52298853  T
119 gaagctgcttatgagcacttggtcagtgatgttccagcagttcgagacgccgctgttttagaaatcgccaaagatgtcactggcactgcgctcacacatt 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||    
52298854 gaagctgcttatgagcacttggtcagtgatgttccagcagttcgagacgccgctgtttcagaaatcgccaaagatgtcactggcaccgcgctcacacatt 52298953  T
219 ttacaccaacttcctcttcaacttcaatcaccac 252  Q
    ||||||||||||||||||||||||||||||||||    
52298954 ttacaccaacttcctcttcaacttcaatcaccac 52298987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 66
Target Start/End: Original strand, 7550006 - 7550051
Alignment:
21 tggacgagagggagaaggtggtgaggcacatgtgggatgtgtacac 66  Q
    |||| ||||||||||| ||||||||||| |||||||||||||||||    
7550006 tggaggagagggagaaagtggtgaggcatatgtgggatgtgtacac 7550051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University