View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19582_high_23 (Length: 274)
Name: NF19582_high_23
Description: NF19582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19582_high_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 262
Target Start/End: Complemental strand, 27244011 - 27243767
Alignment:
| Q |
19 |
caaatcagtggaagtctttagattgatttttcaaccatcatcaagaaaacaatttgatgggatcgattgatcgatcaaatatcatttgtctctacatcct |
118 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27244011 |
caaatcagtggaagtccttagactgatttttcaaccatcatcaagaaaacaatttgatgggatcgattgatcgatcaaatatcatttgtctctacatcct |
27243912 |
T |
|
| Q |
119 |
taac-gttaacaccgcattgtaaattggtgagagagtgatagtgctcttatgatagttgtaaacattgatctattattacctttgagtagtagcaaaggt |
217 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27243911 |
taatagttaacaccgcattgtaaattggtgagagagtgatagtgctcttatgatagatgtaaacattgatctattattacctttgagtagtagcaaaggt |
27243812 |
T |
|
| Q |
218 |
ccccatttccctctagtaataaaagatagaagtatggtgaatatt |
262 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27243811 |
ccccatttccctctagtaataaaggatagaagtatggtgaatatt |
27243767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University